Review



algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst  (Oxford Instruments)


Bioz Verified Symbol Oxford Instruments is a verified supplier
Bioz Manufacturer Symbol Oxford Instruments manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Oxford Instruments algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst
    Algorithms Bitplane Imaris 9 2 Oxford Instruments Rrid Scr 007370 Fiji Nih Rrid Scr 002285 Clearmap 3 1 Kirst, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44196 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/Imaris/pm41985458-259-279-280
    Average 99 stars, based on 44196 article reviews
    algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Fluorescence:

    Article Title: Mast cell secretory granule fusion with amphisomes coordinates their homotypic fusion and release of exosomes.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PH-PLCd-GFP A kind gift from Dr. T. Balla (Bethesda, MD, USA) N/A FYVE-GFP A kind gift from Dr. A. Rudich (Ben-Gurion University, Israel) N/A EGFP-NES-cPHx3 A gift from Gerry Hammond http://n2t.net/addgene:116855 RRID:Addgene_116855 WT dynamin 2 pEGFP A gift from Sandra Schmid http://n2t. net/addgene:34686 RRID:Addgene_34686 mCherry-FKBP-PI4KAC1001 A gift from Gerry Hammond http://n2t.net/addgene:139311 RRID:Addgene_139311 mCherry-FKBP-PI4KAC1001(D1957A) A gift from Gerry Hammond http://n2t.net/addgene:139312 RRID:Addgene_139312 mEGFP-PI35P2 A gift from Geert can den Bogaart http://n2t.net/addgene:92419 RRID:Addgene_92419 Neuropeptide Y (NPY) fused to monomeric red fluorescence protein (NPY-mRFP) A kind gift from Dr. U. Ashery (Tel-Aviv University, Israel) N/A pEF-HA-WT-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-C515S-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-K55M/K184M(KMKM)-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pcDNA3-EGFP A kind gift from Dr. J. Silvio Gutkind (University of California, 83 San Diego, USA) N/A pEGFP-CD63 A kind gift from Dr. J. P. Luzio (University of Cambridge, UK) N/A GFP-K44A-dynamin 2 A kind gift from Dr. E. Perlson (Tel-Aviv University, Israel) N/A GFP-LC3(G120A) A kind gift from Dr. A. Tolkovsky (Univeristy of Cambridge, UK) N/A CD63 CRISPR All-in-one AAV vector (pNVsgRNA-Cas9-2A-GFP) Target 1–92: AACCTGAACTGCTACGCCAA Applied Biological Materials Inc. (abm) (Viking Way, Richmond, BC, Canada) Cat #155601160591 Software and algorithms Fiji (extended ImageJ version 2.3.0/1.53k) Schindelin et al.71 https://imagej.net/software/fiji/ Bitplane Scientific Software-Imaris 364 version 9.3.1 Bitplane, Oxford Instruments, Zurich, Switzerland https://imaris.oxinst.com Adobe Photoshop 2022 version 23.2 Adobe Software www.adobe.com GraphPad Prism version 9.5.1 GraphPad Software, Boston, MA, USA www.graphpad.com 18 Cell Reports 43, 114482, July 23, 2024 .. RBL cells (the RBL-2H3 subline) were maintained at 37 C in a humidified incubator with 5% CO2, in adherent cell cultures in lowglucose DMEM (Cat #01-050-1A, Biological Industries) supplemented with 10% FBS (Cat #10270106, GIBCO), 2 mM L-glutamine (Cat #03-020-1A, Biological Industries), 100 mg/mL streptomycin, 100 units/ml penicillin and 12.5 units/ml nystatin (Biological Industries).

    CRISPR:

    Article Title: Mast cell secretory granule fusion with amphisomes coordinates their homotypic fusion and release of exosomes.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PH-PLCd-GFP A kind gift from Dr. T. Balla (Bethesda, MD, USA) N/A FYVE-GFP A kind gift from Dr. A. Rudich (Ben-Gurion University, Israel) N/A EGFP-NES-cPHx3 A gift from Gerry Hammond http://n2t.net/addgene:116855 RRID:Addgene_116855 WT dynamin 2 pEGFP A gift from Sandra Schmid http://n2t. net/addgene:34686 RRID:Addgene_34686 mCherry-FKBP-PI4KAC1001 A gift from Gerry Hammond http://n2t.net/addgene:139311 RRID:Addgene_139311 mCherry-FKBP-PI4KAC1001(D1957A) A gift from Gerry Hammond http://n2t.net/addgene:139312 RRID:Addgene_139312 mEGFP-PI35P2 A gift from Geert can den Bogaart http://n2t.net/addgene:92419 RRID:Addgene_92419 Neuropeptide Y (NPY) fused to monomeric red fluorescence protein (NPY-mRFP) A kind gift from Dr. U. Ashery (Tel-Aviv University, Israel) N/A pEF-HA-WT-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-C515S-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-K55M/K184M(KMKM)-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pcDNA3-EGFP A kind gift from Dr. J. Silvio Gutkind (University of California, 83 San Diego, USA) N/A pEGFP-CD63 A kind gift from Dr. J. P. Luzio (University of Cambridge, UK) N/A GFP-K44A-dynamin 2 A kind gift from Dr. E. Perlson (Tel-Aviv University, Israel) N/A GFP-LC3(G120A) A kind gift from Dr. A. Tolkovsky (Univeristy of Cambridge, UK) N/A CD63 CRISPR All-in-one AAV vector (pNVsgRNA-Cas9-2A-GFP) Target 1–92: AACCTGAACTGCTACGCCAA Applied Biological Materials Inc. (abm) (Viking Way, Richmond, BC, Canada) Cat #155601160591 Software and algorithms Fiji (extended ImageJ version 2.3.0/1.53k) Schindelin et al.71 https://imagej.net/software/fiji/ Bitplane Scientific Software-Imaris 364 version 9.3.1 Bitplane, Oxford Instruments, Zurich, Switzerland https://imaris.oxinst.com Adobe Photoshop 2022 version 23.2 Adobe Software www.adobe.com GraphPad Prism version 9.5.1 GraphPad Software, Boston, MA, USA www.graphpad.com 18 Cell Reports 43, 114482, July 23, 2024 .. RBL cells (the RBL-2H3 subline) were maintained at 37 C in a humidified incubator with 5% CO2, in adherent cell cultures in lowglucose DMEM (Cat #01-050-1A, Biological Industries) supplemented with 10% FBS (Cat #10270106, GIBCO), 2 mM L-glutamine (Cat #03-020-1A, Biological Industries), 100 mg/mL streptomycin, 100 units/ml penicillin and 12.5 units/ml nystatin (Biological Industries).

    Article Title: Clusters of neuronal neurofascin prefigure the position of a subset of nodes of Ranvier along individual central nervous system axons in vivo
    Article Snippet: .. RRID: AB_2905463 goat anti-mouse IgG, Alexa Fluor 633 Thermo Fisher RRID: AB_2535719 goat anti-rabbit IgG, Alexa Fluor 555 Thermo Fisher RRID: AB_141784 goat anti-chicken IgY, Alexa Fluor 488 Thermo Fisher RRID: AB_142924 Experimental models: Organisms/strains Tg(mbp:memCerulean)tum101Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-3 Tg(mbp:KillerRed)tum103Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-5 Tg(mbp:tagRFPt-CAAX)tum102Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-4 Tg(cntn1b(3kb):KalTA4) This paper N/A Tg(olig1:mScarlet-CAAX) This paper N/A CRISPR-NfascaD28 This paper N/A Oligonucleotides For all oligonucleotides used, see Table S1 this paper N/A Recombinant DNA p5E_cntn1b(3kb) this paper N/A pME_EYFPnostop_NaV-II-III this paper N/A pME_sigpepEYFP_cntn1a this paper N/A p5E_cntn1b(5kb) Czopka et al. (2013) N/A pME_KalTA4GI Almeida and Lyons (2015) N/A p5E_UAS(10x) Kwan et al. (2007) N/A p3E_pA Kwan et al. (2007) N/A pDestTol2_pA Kwan et al. (2007) N/A pME_tagCFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):Nfasca-EYFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):EYFP-NaV-II-III this paper N/A pTol2_UAS(10x):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):tagCFP this paper N/A pTol2_cntn1b(5kb):mCherry Czopka et al. (2013) N/A Software and algorithms Fiji http://fiji.sc/ RRID: SCR_002285 Imaris Bitplane RRID: SCR_007370 Imaris FilamentTracer Bitplane RRID: SCR_007366 Huygens Essential Scientific Volume Imaging RRID: SCR_014237 Graphpad Prism 8 Graphpad Software RRID: SCR_015807 Code for simulation of cluster-node correlation This paper ZENODO DOI: https://doi.org/10.5281/zenodo.5846391. ..

    Bioprocessing:

    Article Title: Mast cell secretory granule fusion with amphisomes coordinates their homotypic fusion and release of exosomes.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PH-PLCd-GFP A kind gift from Dr. T. Balla (Bethesda, MD, USA) N/A FYVE-GFP A kind gift from Dr. A. Rudich (Ben-Gurion University, Israel) N/A EGFP-NES-cPHx3 A gift from Gerry Hammond http://n2t.net/addgene:116855 RRID:Addgene_116855 WT dynamin 2 pEGFP A gift from Sandra Schmid http://n2t. net/addgene:34686 RRID:Addgene_34686 mCherry-FKBP-PI4KAC1001 A gift from Gerry Hammond http://n2t.net/addgene:139311 RRID:Addgene_139311 mCherry-FKBP-PI4KAC1001(D1957A) A gift from Gerry Hammond http://n2t.net/addgene:139312 RRID:Addgene_139312 mEGFP-PI35P2 A gift from Geert can den Bogaart http://n2t.net/addgene:92419 RRID:Addgene_92419 Neuropeptide Y (NPY) fused to monomeric red fluorescence protein (NPY-mRFP) A kind gift from Dr. U. Ashery (Tel-Aviv University, Israel) N/A pEF-HA-WT-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-C515S-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-K55M/K184M(KMKM)-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pcDNA3-EGFP A kind gift from Dr. J. Silvio Gutkind (University of California, 83 San Diego, USA) N/A pEGFP-CD63 A kind gift from Dr. J. P. Luzio (University of Cambridge, UK) N/A GFP-K44A-dynamin 2 A kind gift from Dr. E. Perlson (Tel-Aviv University, Israel) N/A GFP-LC3(G120A) A kind gift from Dr. A. Tolkovsky (Univeristy of Cambridge, UK) N/A CD63 CRISPR All-in-one AAV vector (pNVsgRNA-Cas9-2A-GFP) Target 1–92: AACCTGAACTGCTACGCCAA Applied Biological Materials Inc. (abm) (Viking Way, Richmond, BC, Canada) Cat #155601160591 Software and algorithms Fiji (extended ImageJ version 2.3.0/1.53k) Schindelin et al.71 https://imagej.net/software/fiji/ Bitplane Scientific Software-Imaris 364 version 9.3.1 Bitplane, Oxford Instruments, Zurich, Switzerland https://imaris.oxinst.com Adobe Photoshop 2022 version 23.2 Adobe Software www.adobe.com GraphPad Prism version 9.5.1 GraphPad Software, Boston, MA, USA www.graphpad.com 18 Cell Reports 43, 114482, July 23, 2024 .. RBL cells (the RBL-2H3 subline) were maintained at 37 C in a humidified incubator with 5% CO2, in adherent cell cultures in lowglucose DMEM (Cat #01-050-1A, Biological Industries) supplemented with 10% FBS (Cat #10270106, GIBCO), 2 mM L-glutamine (Cat #03-020-1A, Biological Industries), 100 mg/mL streptomycin, 100 units/ml penicillin and 12.5 units/ml nystatin (Biological Industries).

    Software:

    Article Title: Mast cell secretory granule fusion with amphisomes coordinates their homotypic fusion and release of exosomes.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PH-PLCd-GFP A kind gift from Dr. T. Balla (Bethesda, MD, USA) N/A FYVE-GFP A kind gift from Dr. A. Rudich (Ben-Gurion University, Israel) N/A EGFP-NES-cPHx3 A gift from Gerry Hammond http://n2t.net/addgene:116855 RRID:Addgene_116855 WT dynamin 2 pEGFP A gift from Sandra Schmid http://n2t. net/addgene:34686 RRID:Addgene_34686 mCherry-FKBP-PI4KAC1001 A gift from Gerry Hammond http://n2t.net/addgene:139311 RRID:Addgene_139311 mCherry-FKBP-PI4KAC1001(D1957A) A gift from Gerry Hammond http://n2t.net/addgene:139312 RRID:Addgene_139312 mEGFP-PI35P2 A gift from Geert can den Bogaart http://n2t.net/addgene:92419 RRID:Addgene_92419 Neuropeptide Y (NPY) fused to monomeric red fluorescence protein (NPY-mRFP) A kind gift from Dr. U. Ashery (Tel-Aviv University, Israel) N/A pEF-HA-WT-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-C515S-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pEF-HA-K55M/K184M(KMKM)-PTPN9 A kind gift from Dr. T. Mustelin (UC, San Diego, USA) N/A pcDNA3-EGFP A kind gift from Dr. J. Silvio Gutkind (University of California, 83 San Diego, USA) N/A pEGFP-CD63 A kind gift from Dr. J. P. Luzio (University of Cambridge, UK) N/A GFP-K44A-dynamin 2 A kind gift from Dr. E. Perlson (Tel-Aviv University, Israel) N/A GFP-LC3(G120A) A kind gift from Dr. A. Tolkovsky (Univeristy of Cambridge, UK) N/A CD63 CRISPR All-in-one AAV vector (pNVsgRNA-Cas9-2A-GFP) Target 1–92: AACCTGAACTGCTACGCCAA Applied Biological Materials Inc. (abm) (Viking Way, Richmond, BC, Canada) Cat #155601160591 Software and algorithms Fiji (extended ImageJ version 2.3.0/1.53k) Schindelin et al.71 https://imagej.net/software/fiji/ Bitplane Scientific Software-Imaris 364 version 9.3.1 Bitplane, Oxford Instruments, Zurich, Switzerland https://imaris.oxinst.com Adobe Photoshop 2022 version 23.2 Adobe Software www.adobe.com GraphPad Prism version 9.5.1 GraphPad Software, Boston, MA, USA www.graphpad.com 18 Cell Reports 43, 114482, July 23, 2024 .. RBL cells (the RBL-2H3 subline) were maintained at 37 C in a humidified incubator with 5% CO2, in adherent cell cultures in lowglucose DMEM (Cat #01-050-1A, Biological Industries) supplemented with 10% FBS (Cat #10270106, GIBCO), 2 mM L-glutamine (Cat #03-020-1A, Biological Industries), 100 mg/mL streptomycin, 100 units/ml penicillin and 12.5 units/ml nystatin (Biological Industries).

    Article Title: Early molecular layer interneuron hyperactivity triggers Purkinje neuron degeneration in SCA1
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti parvalbumin Swant Cat#235; RRID: AB_10000343 Goat anti parvalbumin Swant Cat#PVG214; RRID: AB_10000345 Mouse anti calbindin Abcam Cat#ab82812; RRID: AB_1658451 Rabbit anti calbindin Abcam Cat#ab108404; RRID: AB_10861236 Rabbit anti-pCaMKII-a Santa cruz Cat#sc-12886-R; RRID: AB_2067915 Rabbit anti-CaMKII-a Lifespan Bio Cat#1178-50; RRID: AB_968870 Goat anti mCherry Origene Cat#AB0081; RRID: AB_2333094 Rabbit polyclonal anti mCherry Abcam Cat#ab183628; RRID: AB_2650480 Rabbit anti VGluT1 SYSY Cat#135303; RRID: AB_887875 Rabbit anti VGAT SYSY Cat#131003; RRID: AB_887869 Rabbit anti HOMER-3 Origene Cat#TA308627 Rabbit anti HOMER-3 SYSY Cat#160303; RRID: AB_10804288 Mouse anti GFP ABCAM Cat#AB1218; RRID: AB_298911 Mouse anti myc Cell signaling Cat# 2276; RRID: AB_331783 Mouse anti Frrs1l Santa cruz Cat# sc-398692 Mouse anti GluR2 Millipore Cat#MAB397; RRID: AB_11212990 Chicken anti MAP2 Sigma/Millipore Cat#AB15452; RRID: AB_805385 rabbit anti GABA Sigma Cat#A2052; RRID: AB_477652 Rabbit anti KV1.2 Thermo Fisher Scientific Cat# PA5-77578; RRID: AB_2736054 Rabbit anti-GFAP Sigma Cat#G4546; RRID: AB_1840895 Rabbit anti-SORCS3 Novus Cat##NBP1-30615; RRID: AB_2192266 Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen, Thermo Fisher Scientific Catalog # A-11058 Neurotrace 435/455 blue fluorescent Nissl stain Invitrogen, Thermo Fisher Scientific Catalog number: N21479 Bacterial and virus strains AAV2/1-hSyn-GCaMP7S-WPRE Dana et al.20 Addgene: 104487-AAV1 AAV2/1-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV1 AAV2/2-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV2 AAV2/8-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV8 AAV2/8-hSyn-DIO-hM3D(Gq)-mCherry Krashes et al.77 Addgene: 44361-AAV8 AAV2/8-hSyn-DIO-hM4D(Gi)-mCherry Krashes et al.77 Addgene: 44362-AAV8 AAV2/2-hSyn-DIO-hM4D(Gi)-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50475-AAV2 AAV2/1-hSyn-GCaMP6s-WPRE-SV40 Chen et al.19 Addgene: 100843-AAV1 AAV2/1-Syn-NES-jRCaMP1a-WPRE-SV40 Dana et al.78 Addgene: 100848-AAV1 AAV2/1-hSyn-Twitch2B-WPRE-SV40 Thestrup et al.23 Addgene: 100040- AAV1 (Continued on next page) e1 Neuron 111, 2523–2543.e1–e10, August 16, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER C9orf4 (FRRS1L) - Human shRNA lentiviral particles Origene: CAT# TL314264V C9ORF4 (FRRS1L) - Human Myc-DDKtagged lentiviral particles Origene: CAT#: RC221300L1V Chemicals, peptides, and recombinant proteins SB 431542 Stem cell technologies Cat#72234 LDN193189 Stem cell technologies Cat#72147 CHIR99021 Stem cell technologies Cat#72052 L-Ascorbic Acid Sigma Aldrich Cat#A4403 SAG Stem cell technologies Cat#73412 BDNF Stem cell technologies Cat#78005 DAPT Stem cell technologies Cat#72082 GDNF Stem cell technologies Cat#78058 IGF-1 Stem cell technologies Cat#78078 CNTF Stem cell technologies Cat#78010 Clozapine N-Oxide Tocris Cat#4936 Experimental models: Cell lines Human induced pluripotent stem cell (SCA1) Buijsen et al.38 LUMCi002 Human induced pluripotent stem cell (Healthy) Buijsen et al.38 LUMCi003 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi034 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi035 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi022 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi023 Experimental models: Organisms/strains B6.129S-Atxn1tm1Hzo/J Jackson laboratories RRID: IMSR_JAX:005601 B6;129P2-Pvalbtm1(cre)Arbr/J Jackson laboratories RRID: IMSR_JAX:008069 B6.129-Tg(Pcp2-cre)2Mpin/J Jackson laboratories RRID: IMSR_JAX:004146 Software and algorithms Fiji https://doi.org/10.1038/nmeth.2019 RRID:SCR_002285 Imaris Oxford instruments RRID:SCR_007370 iMOD Kremer et al.79 RRID:SCR_003297 Graphpad prism http://www.graphpad.com/ RRID:SCR_002798 MATLAB R2018a version The MathWorks, Inc https://de.mathworks.com/ RRID:SCR_001622 Custom built software on Labview 2018 SP1, 2020 SP1, National Instruments Keller et al.80 National Instruments https://www.ni.com/de-de/shop/ software/products/labview.html SciScan 1.4 - Imaging acquisition software Scientfica UK N/A Other IR camera Imaging source DMK 22BUC03 Ti:Sapphire laser with a DeepSee pre-chirp unit Spectra Physics MaiTai HP N/A Two-photon microscope, equipped with an 8 kHz resonant scanner Hyperscope, Scientifica N/A 316 water-immersion objective (0.8 NA) Nikon N/A (Continued on next page) ll OPEN ACCESSArticle Neuron 111, 2523–2543.e1–e10, August 16, 2023 e2 ..

    Article Title: Spatial organization and function of RNA molecules within phase-separated condensates in zebrafish are controlled by Dnd1.
    Article Snippet: Agarose Invitrogen Cat# 15517014 DMDAPatA Daniel Romo N/A CHX Sigma Cat# C4859 DAPI ACD Cat# 320858 DMSO AppliChem Cat# A3672 Critical commercial assays Manual RNAscope Multiplex Fluorescent Detection Reagents ACD Cat# 320851 RNAscope Protease III and Protease IV reagents ACD Cat# 322340 mMessage mMachine sp6 Kit Thermo Fisher Cat# AM1340 mMessage mMachine T3 Kit Thermo Fisher Cat# AM1348 mMessage mMachine T7 Kit Thermo Fisher Cat# AM1344 Experimental models: Organisms/strains Zebrafish: wildtype strain of the AB(TL) background N/A N/A Zebrafish: cxcr4bt26035 Knaut et al.66 ZFIN: ZDB-ALT-030312-2 Zebrafish: medusaNYO45 Valentin et al.67 ZFIN: ZDB-ALT-060608-480 Zebrafish: tg(kop:egfp-f-nos-3’ UTR;cry:dsred) Blaser et al.45 ZFIN: ZDB-ALT-070406-1 Zebrafish: tg(buc:buc-egfp) Riemer et al.50 ZFIN: ZDB-ALT-151209-1 Zebrafish: bucp106re Bontems et al.49 ZFIN: ZDB-ALT-040224-4 Zebrafish: dicerhu715 Wienholds et al.68 ZFIN: ZDB-ALT-030922-6 Oligonucleotides Injected RNAs See Table S1 See Table S1 (Continued on next page) Developmental Cell 58, 1578–1592.e1–e5, September 11, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Morpholinos See Table S1 See Table S1 miRNA and RNAscope detection probes See Table S1 See Table S1 Software and algorithms Fiji (version 2.0.0-rc-43/1.51a) NIH https://fiji.sc/ Imaris (version 8.4.2) Oxford Instruments https://imaris.oxinst.com/ Huygens Professional (version 19.04) SVI http://svi.nl Prism (version 9.4.0) Graphpad https://www.graphpad.com/scientific- software/prism/ VisiView (version 4.0.0.14) Visitron http://www.visitron.de/Products/ Software/VisiView/visiview.html ZEN (version 2010B SP1, 6.0) Zeiss https://www.zeiss.com/microscopy/ en/products/software/zeiss-zen.html ..

    Article Title: Early stress-induced impaired microglial pruning of excitatory synapses on immature CRH-expressing neurons provokes aberrant adult stress responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-vGlut2 antiserum Millipore Cat# AB2251-I; RRID: AB_2665454 Rabbit anti-PSD95 antiserum Invitrogen/ThermoFisher Cat# 51-6900; RRID: AB_2533914 Rabbit anti-Iba1 antiserum Wako Chemical Cat# 019-19741; RRID: AB_839504 Rat anti-MerTK antiserum eBioscience Cat# 14-5751-82; RRID: AB_2688282 Rabbit anti-P2RY12 antiserum AnaSpec Cat# 55043A; RRID: AB_2298886 Chemicals, peptides, and recombinant proteins Clozapine-N-oxide (CNO) National Institute of Mental Health CAS# 34233-69-7, MH# C-929 MerTK small-molecule inhibitor, UNC2025 Selleck Chemicals Cat# S7576 CNO-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# X-999 Placebo-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# C-111 Critical commercial assays ACTH ELISA kit Phoenix Pharmaceuticals Cat# EK-001-21 CORT ELISA kit Cayman Chemicals Cat# 501320 Experimental models: Organisms/strains Mouse: CRH-IRES-Cre+/+ Jackson Laboratory JAX: 012704 Mouse: tdTomato+/+ Ai14 Jackson Laboratory JAX: 007914 Mouse: CX3CR1-GFP+/+ Jackson Laboratory JAX: 005582 Mouse: CX3CR1-BAC-Cre+ [Tg(Cx3cr1cre)MW126Gsat] GENSAT BAC Transgenic Project (Rockefeller University) MMRRC: 036395-UCD; MGI: 5311737 Mouse: Gq-DREADD+/- (stop-floxed) Jackson Laboratory JAX: 026220 Mouse: Mertkfl/fl Dr. Carla Rothlin (Yale University); Fourgeaud et al., 2016 N/A Mouse: C57BL/6J (wild-type) Jackson Laboratory JAX: 000664 Software and algorithms FIJI https://imagej.net/software/fiji/; Schindelin et al., 2012 N/A Imaris 3D reconstruction software Bitplane N/A Strathclyde Electrophysiology Software (Electrophysiology Data Recorder [WinEDR] and Whole-Cell analysis Program [WinWCP]) Courtesy of Dr J. Dempster, University of Strathclyde N/A Slidebook microscopy software 3i (Intelligent Imaging Innovations) N/A Python-based microglial process dynamics analysis algorithm This paper, available: https:// github.com/jaclynrbeck/ BaramLabMicrogliaTracking N/A ProMoIJ plug-in for FIJI Paris et al., 2017 N/A MultipleKymograph plug-in for FIJI http://www.embl.de/eamnet/ html/body_kymograph.html N/A Other Fine-gauge plastic-coated aluminum mesh platform (mesh dimensions 0.4 X 0.9 cm) McNichols Co. Cat# 57398 Cell Reports 38, 110600, March 29, 2022 e1 ..

    Article Title: The ESCRT machinery counteracts Nesprin-2G-mediated mechanical forces during nuclear envelope repair.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER (S)-3’-amino Blebbistatin Cambridge Bioscience Ltd Cat# CAY24170 Y-27632 dihydrochloride Sigma-Aldrich Cat# Y0503 Critical commercial assays ABI High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Experimental models: cell lines HT1080 ATCC Cat# CRL-7951; RRID: CVCL_0317 HeLa ATCC Cat# CRM-CCL-2; RRID: CVCL_0030 HEK 293T ATCC Cat# CRL-3216; RRID: CVCL_0063 HT1080dLaminA/C De Vos laboratory (Antwerp University) N/A Experimental models: organisms/strains Y190 Yeast Strain Harper et al., 1993 N/A Oligonucleotides siNT: ON-TARGETplus Nontargeting Control siRNA Horizon Discovery (Dharmacon) D-001810-01-50 siBROX: Hs_C1orf58_3 FlexiTube siRNA Qiagen SI04234300 siCHMP7: 5’-GGGAGAAG AUUGUGAAGUUdTdT-3’ Ventimiglia et al., 2018 Horizon Discovery (Dharmacon) Custom siRNA siNesprin-2.1: 5’-GAGUGUCG GAGGGAACUAAUU-3’ Jayo et al., 2016 Horizon Discovery (Dharmacon) Custom siRNA siNesprin-2.2: 5’-GAAGAAAAG GUGCAUGUUAUU-3’ Jayo et al., 2016 Horizon Discovery (Dharmacon) Custom siRNA siUFD-1: 5’-GAGGCAGA UUCGUCGCUUUdTdT-3’ Olmos et al., 2015 Horizon Discovery (Dharmacon) Custom siRNA Recombinant DNA pCMS28 mCherry-NLS Ventimiglia et al, 2018 N/A pCMS28 mCherry-BAF This paper N/A pNG72 GFP-L-BROXr This paper N/A pNG72 GFP-L-BROXr C408S This paper N/A pCMS28 mCherry-Emerin Ventimiglia et al, 2018 N/A pNG72 CHMP4B-L-GFP Ventimiglia et al, 2018 N/A YFP-LAP2b Carlton et al.,2012 N/A pNG72 GFP-Emerin This paper N/A pNG72 GFP-NLS Ventimiglia et al, 2018 N/A pGEX Empty Agromayor et al. 2009 N/A pGEX BROX WT This paper N/A pGEX BROX L350A This paper N/A pGEX BROX H204A This paper N/A pCR3.1 GFP-CHMP4B Ventimiglia et al, 2018 N/A pCR3.1 GFP-empty Ventimiglia et al, 2018 N/A pCR3.1 hmN2GSR29-33 This paper N/A pNG72 GFP-L-BROXr L350A This paper N/A KT7 BROX WT This paper N/A KT7 BROX E137A This paper N/A KT7 BROX H144A This paper N/A KT7 BROX R145A This paper N/A KT7 BROX H204A This paper N/A KT7 BROX L208A This paper N/A KT7 BROX L208/212D This paper N/A (Continued on next page) e2 Developmental Cell 56, 3192–3202.e1–e8, December 6, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER KT7 BROX L212D This paper N/A KT7 BROX K322A This paper N/A KT7 BROX Y348A This paper N/A KT7 BROX Y348A This paper N/A KT7 BROX L350A This paper N/A KT7 BROX I354A This paper N/A HB18 CHMP4B Martin-Serrano et al, 2003 N/A HB18 CHMP5 C-terminal truncation This paper N/A HB18 Nesprin-2 This paper N/A pNG72 GFP-SOUBA This paper N/A HA-Ubiquitin Agromayor and Martin-Serrano, 2006 N/A pCR3.1 FLAG-BROX WT This paper N/A pCR3.1 FLAG-BROX H204A This paper N/A pCR3.1 GFP-hmN2G This paper N/A pCR3.1 FLAG-BROX L350A This paper N/A Software and algorithms FIJI https://fiji.sc/ N/A Prism 9 GraphPad N/A Imaris 9 Bitplane N/A AutoQuant X3 Media Cybernetics N/A UCSF Chimera https://www.cgl.ucsf.edu/chimera/ N/A ..

    Article Title: Clusters of neuronal neurofascin prefigure the position of a subset of nodes of Ranvier along individual central nervous system axons in vivo
    Article Snippet: .. RRID: AB_2905463 goat anti-mouse IgG, Alexa Fluor 633 Thermo Fisher RRID: AB_2535719 goat anti-rabbit IgG, Alexa Fluor 555 Thermo Fisher RRID: AB_141784 goat anti-chicken IgY, Alexa Fluor 488 Thermo Fisher RRID: AB_142924 Experimental models: Organisms/strains Tg(mbp:memCerulean)tum101Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-3 Tg(mbp:KillerRed)tum103Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-5 Tg(mbp:tagRFPt-CAAX)tum102Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-4 Tg(cntn1b(3kb):KalTA4) This paper N/A Tg(olig1:mScarlet-CAAX) This paper N/A CRISPR-NfascaD28 This paper N/A Oligonucleotides For all oligonucleotides used, see Table S1 this paper N/A Recombinant DNA p5E_cntn1b(3kb) this paper N/A pME_EYFPnostop_NaV-II-III this paper N/A pME_sigpepEYFP_cntn1a this paper N/A p5E_cntn1b(5kb) Czopka et al. (2013) N/A pME_KalTA4GI Almeida and Lyons (2015) N/A p5E_UAS(10x) Kwan et al. (2007) N/A p3E_pA Kwan et al. (2007) N/A pDestTol2_pA Kwan et al. (2007) N/A pME_tagCFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):Nfasca-EYFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):EYFP-NaV-II-III this paper N/A pTol2_UAS(10x):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):tagCFP this paper N/A pTol2_cntn1b(5kb):mCherry Czopka et al. (2013) N/A Software and algorithms Fiji http://fiji.sc/ RRID: SCR_002285 Imaris Bitplane RRID: SCR_007370 Imaris FilamentTracer Bitplane RRID: SCR_007366 Huygens Essential Scientific Volume Imaging RRID: SCR_014237 Graphpad Prism 8 Graphpad Software RRID: SCR_015807 Code for simulation of cluster-node correlation This paper ZENODO DOI: https://doi.org/10.5281/zenodo.5846391. ..

    other:

    Article Title: Profiling migration of human monocytes in response to chemotactic and barotactic guidance cues.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Prism (Version 10.1.2) Graphpad N/A R (Version 4.2.1) R Core Team N/A AutoCAD (Version 2019) Autodesk N/A OPEN ACCESS

    shRNA:

    Article Title: Early molecular layer interneuron hyperactivity triggers Purkinje neuron degeneration in SCA1
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti parvalbumin Swant Cat#235; RRID: AB_10000343 Goat anti parvalbumin Swant Cat#PVG214; RRID: AB_10000345 Mouse anti calbindin Abcam Cat#ab82812; RRID: AB_1658451 Rabbit anti calbindin Abcam Cat#ab108404; RRID: AB_10861236 Rabbit anti-pCaMKII-a Santa cruz Cat#sc-12886-R; RRID: AB_2067915 Rabbit anti-CaMKII-a Lifespan Bio Cat#1178-50; RRID: AB_968870 Goat anti mCherry Origene Cat#AB0081; RRID: AB_2333094 Rabbit polyclonal anti mCherry Abcam Cat#ab183628; RRID: AB_2650480 Rabbit anti VGluT1 SYSY Cat#135303; RRID: AB_887875 Rabbit anti VGAT SYSY Cat#131003; RRID: AB_887869 Rabbit anti HOMER-3 Origene Cat#TA308627 Rabbit anti HOMER-3 SYSY Cat#160303; RRID: AB_10804288 Mouse anti GFP ABCAM Cat#AB1218; RRID: AB_298911 Mouse anti myc Cell signaling Cat# 2276; RRID: AB_331783 Mouse anti Frrs1l Santa cruz Cat# sc-398692 Mouse anti GluR2 Millipore Cat#MAB397; RRID: AB_11212990 Chicken anti MAP2 Sigma/Millipore Cat#AB15452; RRID: AB_805385 rabbit anti GABA Sigma Cat#A2052; RRID: AB_477652 Rabbit anti KV1.2 Thermo Fisher Scientific Cat# PA5-77578; RRID: AB_2736054 Rabbit anti-GFAP Sigma Cat#G4546; RRID: AB_1840895 Rabbit anti-SORCS3 Novus Cat##NBP1-30615; RRID: AB_2192266 Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen, Thermo Fisher Scientific Catalog # A-11058 Neurotrace 435/455 blue fluorescent Nissl stain Invitrogen, Thermo Fisher Scientific Catalog number: N21479 Bacterial and virus strains AAV2/1-hSyn-GCaMP7S-WPRE Dana et al.20 Addgene: 104487-AAV1 AAV2/1-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV1 AAV2/2-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV2 AAV2/8-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV8 AAV2/8-hSyn-DIO-hM3D(Gq)-mCherry Krashes et al.77 Addgene: 44361-AAV8 AAV2/8-hSyn-DIO-hM4D(Gi)-mCherry Krashes et al.77 Addgene: 44362-AAV8 AAV2/2-hSyn-DIO-hM4D(Gi)-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50475-AAV2 AAV2/1-hSyn-GCaMP6s-WPRE-SV40 Chen et al.19 Addgene: 100843-AAV1 AAV2/1-Syn-NES-jRCaMP1a-WPRE-SV40 Dana et al.78 Addgene: 100848-AAV1 AAV2/1-hSyn-Twitch2B-WPRE-SV40 Thestrup et al.23 Addgene: 100040- AAV1 (Continued on next page) e1 Neuron 111, 2523–2543.e1–e10, August 16, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER C9orf4 (FRRS1L) - Human shRNA lentiviral particles Origene: CAT# TL314264V C9ORF4 (FRRS1L) - Human Myc-DDKtagged lentiviral particles Origene: CAT#: RC221300L1V Chemicals, peptides, and recombinant proteins SB 431542 Stem cell technologies Cat#72234 LDN193189 Stem cell technologies Cat#72147 CHIR99021 Stem cell technologies Cat#72052 L-Ascorbic Acid Sigma Aldrich Cat#A4403 SAG Stem cell technologies Cat#73412 BDNF Stem cell technologies Cat#78005 DAPT Stem cell technologies Cat#72082 GDNF Stem cell technologies Cat#78058 IGF-1 Stem cell technologies Cat#78078 CNTF Stem cell technologies Cat#78010 Clozapine N-Oxide Tocris Cat#4936 Experimental models: Cell lines Human induced pluripotent stem cell (SCA1) Buijsen et al.38 LUMCi002 Human induced pluripotent stem cell (Healthy) Buijsen et al.38 LUMCi003 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi034 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi035 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi022 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi023 Experimental models: Organisms/strains B6.129S-Atxn1tm1Hzo/J Jackson laboratories RRID: IMSR_JAX:005601 B6;129P2-Pvalbtm1(cre)Arbr/J Jackson laboratories RRID: IMSR_JAX:008069 B6.129-Tg(Pcp2-cre)2Mpin/J Jackson laboratories RRID: IMSR_JAX:004146 Software and algorithms Fiji https://doi.org/10.1038/nmeth.2019 RRID:SCR_002285 Imaris Oxford instruments RRID:SCR_007370 iMOD Kremer et al.79 RRID:SCR_003297 Graphpad prism http://www.graphpad.com/ RRID:SCR_002798 MATLAB R2018a version The MathWorks, Inc https://de.mathworks.com/ RRID:SCR_001622 Custom built software on Labview 2018 SP1, 2020 SP1, National Instruments Keller et al.80 National Instruments https://www.ni.com/de-de/shop/ software/products/labview.html SciScan 1.4 - Imaging acquisition software Scientfica UK N/A Other IR camera Imaging source DMK 22BUC03 Ti:Sapphire laser with a DeepSee pre-chirp unit Spectra Physics MaiTai HP N/A Two-photon microscope, equipped with an 8 kHz resonant scanner Hyperscope, Scientifica N/A 316 water-immersion objective (0.8 NA) Nikon N/A (Continued on next page) ll OPEN ACCESSArticle Neuron 111, 2523–2543.e1–e10, August 16, 2023 e2 ..

    Recombinant:

    Article Title: Early molecular layer interneuron hyperactivity triggers Purkinje neuron degeneration in SCA1
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti parvalbumin Swant Cat#235; RRID: AB_10000343 Goat anti parvalbumin Swant Cat#PVG214; RRID: AB_10000345 Mouse anti calbindin Abcam Cat#ab82812; RRID: AB_1658451 Rabbit anti calbindin Abcam Cat#ab108404; RRID: AB_10861236 Rabbit anti-pCaMKII-a Santa cruz Cat#sc-12886-R; RRID: AB_2067915 Rabbit anti-CaMKII-a Lifespan Bio Cat#1178-50; RRID: AB_968870 Goat anti mCherry Origene Cat#AB0081; RRID: AB_2333094 Rabbit polyclonal anti mCherry Abcam Cat#ab183628; RRID: AB_2650480 Rabbit anti VGluT1 SYSY Cat#135303; RRID: AB_887875 Rabbit anti VGAT SYSY Cat#131003; RRID: AB_887869 Rabbit anti HOMER-3 Origene Cat#TA308627 Rabbit anti HOMER-3 SYSY Cat#160303; RRID: AB_10804288 Mouse anti GFP ABCAM Cat#AB1218; RRID: AB_298911 Mouse anti myc Cell signaling Cat# 2276; RRID: AB_331783 Mouse anti Frrs1l Santa cruz Cat# sc-398692 Mouse anti GluR2 Millipore Cat#MAB397; RRID: AB_11212990 Chicken anti MAP2 Sigma/Millipore Cat#AB15452; RRID: AB_805385 rabbit anti GABA Sigma Cat#A2052; RRID: AB_477652 Rabbit anti KV1.2 Thermo Fisher Scientific Cat# PA5-77578; RRID: AB_2736054 Rabbit anti-GFAP Sigma Cat#G4546; RRID: AB_1840895 Rabbit anti-SORCS3 Novus Cat##NBP1-30615; RRID: AB_2192266 Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen, Thermo Fisher Scientific Catalog # A-11058 Neurotrace 435/455 blue fluorescent Nissl stain Invitrogen, Thermo Fisher Scientific Catalog number: N21479 Bacterial and virus strains AAV2/1-hSyn-GCaMP7S-WPRE Dana et al.20 Addgene: 104487-AAV1 AAV2/1-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV1 AAV2/2-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV2 AAV2/8-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV8 AAV2/8-hSyn-DIO-hM3D(Gq)-mCherry Krashes et al.77 Addgene: 44361-AAV8 AAV2/8-hSyn-DIO-hM4D(Gi)-mCherry Krashes et al.77 Addgene: 44362-AAV8 AAV2/2-hSyn-DIO-hM4D(Gi)-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50475-AAV2 AAV2/1-hSyn-GCaMP6s-WPRE-SV40 Chen et al.19 Addgene: 100843-AAV1 AAV2/1-Syn-NES-jRCaMP1a-WPRE-SV40 Dana et al.78 Addgene: 100848-AAV1 AAV2/1-hSyn-Twitch2B-WPRE-SV40 Thestrup et al.23 Addgene: 100040- AAV1 (Continued on next page) e1 Neuron 111, 2523–2543.e1–e10, August 16, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER C9orf4 (FRRS1L) - Human shRNA lentiviral particles Origene: CAT# TL314264V C9ORF4 (FRRS1L) - Human Myc-DDKtagged lentiviral particles Origene: CAT#: RC221300L1V Chemicals, peptides, and recombinant proteins SB 431542 Stem cell technologies Cat#72234 LDN193189 Stem cell technologies Cat#72147 CHIR99021 Stem cell technologies Cat#72052 L-Ascorbic Acid Sigma Aldrich Cat#A4403 SAG Stem cell technologies Cat#73412 BDNF Stem cell technologies Cat#78005 DAPT Stem cell technologies Cat#72082 GDNF Stem cell technologies Cat#78058 IGF-1 Stem cell technologies Cat#78078 CNTF Stem cell technologies Cat#78010 Clozapine N-Oxide Tocris Cat#4936 Experimental models: Cell lines Human induced pluripotent stem cell (SCA1) Buijsen et al.38 LUMCi002 Human induced pluripotent stem cell (Healthy) Buijsen et al.38 LUMCi003 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi034 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi035 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi022 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi023 Experimental models: Organisms/strains B6.129S-Atxn1tm1Hzo/J Jackson laboratories RRID: IMSR_JAX:005601 B6;129P2-Pvalbtm1(cre)Arbr/J Jackson laboratories RRID: IMSR_JAX:008069 B6.129-Tg(Pcp2-cre)2Mpin/J Jackson laboratories RRID: IMSR_JAX:004146 Software and algorithms Fiji https://doi.org/10.1038/nmeth.2019 RRID:SCR_002285 Imaris Oxford instruments RRID:SCR_007370 iMOD Kremer et al.79 RRID:SCR_003297 Graphpad prism http://www.graphpad.com/ RRID:SCR_002798 MATLAB R2018a version The MathWorks, Inc https://de.mathworks.com/ RRID:SCR_001622 Custom built software on Labview 2018 SP1, 2020 SP1, National Instruments Keller et al.80 National Instruments https://www.ni.com/de-de/shop/ software/products/labview.html SciScan 1.4 - Imaging acquisition software Scientfica UK N/A Other IR camera Imaging source DMK 22BUC03 Ti:Sapphire laser with a DeepSee pre-chirp unit Spectra Physics MaiTai HP N/A Two-photon microscope, equipped with an 8 kHz resonant scanner Hyperscope, Scientifica N/A 316 water-immersion objective (0.8 NA) Nikon N/A (Continued on next page) ll OPEN ACCESSArticle Neuron 111, 2523–2543.e1–e10, August 16, 2023 e2 ..

    Article Title: Early stress-induced impaired microglial pruning of excitatory synapses on immature CRH-expressing neurons provokes aberrant adult stress responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-vGlut2 antiserum Millipore Cat# AB2251-I; RRID: AB_2665454 Rabbit anti-PSD95 antiserum Invitrogen/ThermoFisher Cat# 51-6900; RRID: AB_2533914 Rabbit anti-Iba1 antiserum Wako Chemical Cat# 019-19741; RRID: AB_839504 Rat anti-MerTK antiserum eBioscience Cat# 14-5751-82; RRID: AB_2688282 Rabbit anti-P2RY12 antiserum AnaSpec Cat# 55043A; RRID: AB_2298886 Chemicals, peptides, and recombinant proteins Clozapine-N-oxide (CNO) National Institute of Mental Health CAS# 34233-69-7, MH# C-929 MerTK small-molecule inhibitor, UNC2025 Selleck Chemicals Cat# S7576 CNO-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# X-999 Placebo-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# C-111 Critical commercial assays ACTH ELISA kit Phoenix Pharmaceuticals Cat# EK-001-21 CORT ELISA kit Cayman Chemicals Cat# 501320 Experimental models: Organisms/strains Mouse: CRH-IRES-Cre+/+ Jackson Laboratory JAX: 012704 Mouse: tdTomato+/+ Ai14 Jackson Laboratory JAX: 007914 Mouse: CX3CR1-GFP+/+ Jackson Laboratory JAX: 005582 Mouse: CX3CR1-BAC-Cre+ [Tg(Cx3cr1cre)MW126Gsat] GENSAT BAC Transgenic Project (Rockefeller University) MMRRC: 036395-UCD; MGI: 5311737 Mouse: Gq-DREADD+/- (stop-floxed) Jackson Laboratory JAX: 026220 Mouse: Mertkfl/fl Dr. Carla Rothlin (Yale University); Fourgeaud et al., 2016 N/A Mouse: C57BL/6J (wild-type) Jackson Laboratory JAX: 000664 Software and algorithms FIJI https://imagej.net/software/fiji/; Schindelin et al., 2012 N/A Imaris 3D reconstruction software Bitplane N/A Strathclyde Electrophysiology Software (Electrophysiology Data Recorder [WinEDR] and Whole-Cell analysis Program [WinWCP]) Courtesy of Dr J. Dempster, University of Strathclyde N/A Slidebook microscopy software 3i (Intelligent Imaging Innovations) N/A Python-based microglial process dynamics analysis algorithm This paper, available: https:// github.com/jaclynrbeck/ BaramLabMicrogliaTracking N/A ProMoIJ plug-in for FIJI Paris et al., 2017 N/A MultipleKymograph plug-in for FIJI http://www.embl.de/eamnet/ html/body_kymograph.html N/A Other Fine-gauge plastic-coated aluminum mesh platform (mesh dimensions 0.4 X 0.9 cm) McNichols Co. Cat# 57398 Cell Reports 38, 110600, March 29, 2022 e1 ..

    Article Title: Clusters of neuronal neurofascin prefigure the position of a subset of nodes of Ranvier along individual central nervous system axons in vivo
    Article Snippet: .. RRID: AB_2905463 goat anti-mouse IgG, Alexa Fluor 633 Thermo Fisher RRID: AB_2535719 goat anti-rabbit IgG, Alexa Fluor 555 Thermo Fisher RRID: AB_141784 goat anti-chicken IgY, Alexa Fluor 488 Thermo Fisher RRID: AB_142924 Experimental models: Organisms/strains Tg(mbp:memCerulean)tum101Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-3 Tg(mbp:KillerRed)tum103Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-5 Tg(mbp:tagRFPt-CAAX)tum102Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-4 Tg(cntn1b(3kb):KalTA4) This paper N/A Tg(olig1:mScarlet-CAAX) This paper N/A CRISPR-NfascaD28 This paper N/A Oligonucleotides For all oligonucleotides used, see Table S1 this paper N/A Recombinant DNA p5E_cntn1b(3kb) this paper N/A pME_EYFPnostop_NaV-II-III this paper N/A pME_sigpepEYFP_cntn1a this paper N/A p5E_cntn1b(5kb) Czopka et al. (2013) N/A pME_KalTA4GI Almeida and Lyons (2015) N/A p5E_UAS(10x) Kwan et al. (2007) N/A p3E_pA Kwan et al. (2007) N/A pDestTol2_pA Kwan et al. (2007) N/A pME_tagCFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):Nfasca-EYFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):EYFP-NaV-II-III this paper N/A pTol2_UAS(10x):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):tagCFP this paper N/A pTol2_cntn1b(5kb):mCherry Czopka et al. (2013) N/A Software and algorithms Fiji http://fiji.sc/ RRID: SCR_002285 Imaris Bitplane RRID: SCR_007370 Imaris FilamentTracer Bitplane RRID: SCR_007366 Huygens Essential Scientific Volume Imaging RRID: SCR_014237 Graphpad Prism 8 Graphpad Software RRID: SCR_015807 Code for simulation of cluster-node correlation This paper ZENODO DOI: https://doi.org/10.5281/zenodo.5846391. ..

    Imaging:

    Article Title: Early molecular layer interneuron hyperactivity triggers Purkinje neuron degeneration in SCA1
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti parvalbumin Swant Cat#235; RRID: AB_10000343 Goat anti parvalbumin Swant Cat#PVG214; RRID: AB_10000345 Mouse anti calbindin Abcam Cat#ab82812; RRID: AB_1658451 Rabbit anti calbindin Abcam Cat#ab108404; RRID: AB_10861236 Rabbit anti-pCaMKII-a Santa cruz Cat#sc-12886-R; RRID: AB_2067915 Rabbit anti-CaMKII-a Lifespan Bio Cat#1178-50; RRID: AB_968870 Goat anti mCherry Origene Cat#AB0081; RRID: AB_2333094 Rabbit polyclonal anti mCherry Abcam Cat#ab183628; RRID: AB_2650480 Rabbit anti VGluT1 SYSY Cat#135303; RRID: AB_887875 Rabbit anti VGAT SYSY Cat#131003; RRID: AB_887869 Rabbit anti HOMER-3 Origene Cat#TA308627 Rabbit anti HOMER-3 SYSY Cat#160303; RRID: AB_10804288 Mouse anti GFP ABCAM Cat#AB1218; RRID: AB_298911 Mouse anti myc Cell signaling Cat# 2276; RRID: AB_331783 Mouse anti Frrs1l Santa cruz Cat# sc-398692 Mouse anti GluR2 Millipore Cat#MAB397; RRID: AB_11212990 Chicken anti MAP2 Sigma/Millipore Cat#AB15452; RRID: AB_805385 rabbit anti GABA Sigma Cat#A2052; RRID: AB_477652 Rabbit anti KV1.2 Thermo Fisher Scientific Cat# PA5-77578; RRID: AB_2736054 Rabbit anti-GFAP Sigma Cat#G4546; RRID: AB_1840895 Rabbit anti-SORCS3 Novus Cat##NBP1-30615; RRID: AB_2192266 Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen, Thermo Fisher Scientific Catalog # A-11058 Neurotrace 435/455 blue fluorescent Nissl stain Invitrogen, Thermo Fisher Scientific Catalog number: N21479 Bacterial and virus strains AAV2/1-hSyn-GCaMP7S-WPRE Dana et al.20 Addgene: 104487-AAV1 AAV2/1-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV1 AAV2/2-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV2 AAV2/8-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV8 AAV2/8-hSyn-DIO-hM3D(Gq)-mCherry Krashes et al.77 Addgene: 44361-AAV8 AAV2/8-hSyn-DIO-hM4D(Gi)-mCherry Krashes et al.77 Addgene: 44362-AAV8 AAV2/2-hSyn-DIO-hM4D(Gi)-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50475-AAV2 AAV2/1-hSyn-GCaMP6s-WPRE-SV40 Chen et al.19 Addgene: 100843-AAV1 AAV2/1-Syn-NES-jRCaMP1a-WPRE-SV40 Dana et al.78 Addgene: 100848-AAV1 AAV2/1-hSyn-Twitch2B-WPRE-SV40 Thestrup et al.23 Addgene: 100040- AAV1 (Continued on next page) e1 Neuron 111, 2523–2543.e1–e10, August 16, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER C9orf4 (FRRS1L) - Human shRNA lentiviral particles Origene: CAT# TL314264V C9ORF4 (FRRS1L) - Human Myc-DDKtagged lentiviral particles Origene: CAT#: RC221300L1V Chemicals, peptides, and recombinant proteins SB 431542 Stem cell technologies Cat#72234 LDN193189 Stem cell technologies Cat#72147 CHIR99021 Stem cell technologies Cat#72052 L-Ascorbic Acid Sigma Aldrich Cat#A4403 SAG Stem cell technologies Cat#73412 BDNF Stem cell technologies Cat#78005 DAPT Stem cell technologies Cat#72082 GDNF Stem cell technologies Cat#78058 IGF-1 Stem cell technologies Cat#78078 CNTF Stem cell technologies Cat#78010 Clozapine N-Oxide Tocris Cat#4936 Experimental models: Cell lines Human induced pluripotent stem cell (SCA1) Buijsen et al.38 LUMCi002 Human induced pluripotent stem cell (Healthy) Buijsen et al.38 LUMCi003 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi034 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi035 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi022 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi023 Experimental models: Organisms/strains B6.129S-Atxn1tm1Hzo/J Jackson laboratories RRID: IMSR_JAX:005601 B6;129P2-Pvalbtm1(cre)Arbr/J Jackson laboratories RRID: IMSR_JAX:008069 B6.129-Tg(Pcp2-cre)2Mpin/J Jackson laboratories RRID: IMSR_JAX:004146 Software and algorithms Fiji https://doi.org/10.1038/nmeth.2019 RRID:SCR_002285 Imaris Oxford instruments RRID:SCR_007370 iMOD Kremer et al.79 RRID:SCR_003297 Graphpad prism http://www.graphpad.com/ RRID:SCR_002798 MATLAB R2018a version The MathWorks, Inc https://de.mathworks.com/ RRID:SCR_001622 Custom built software on Labview 2018 SP1, 2020 SP1, National Instruments Keller et al.80 National Instruments https://www.ni.com/de-de/shop/ software/products/labview.html SciScan 1.4 - Imaging acquisition software Scientfica UK N/A Other IR camera Imaging source DMK 22BUC03 Ti:Sapphire laser with a DeepSee pre-chirp unit Spectra Physics MaiTai HP N/A Two-photon microscope, equipped with an 8 kHz resonant scanner Hyperscope, Scientifica N/A 316 water-immersion objective (0.8 NA) Nikon N/A (Continued on next page) ll OPEN ACCESSArticle Neuron 111, 2523–2543.e1–e10, August 16, 2023 e2 ..

    Article Title: Clusters of neuronal neurofascin prefigure the position of a subset of nodes of Ranvier along individual central nervous system axons in vivo
    Article Snippet: .. RRID: AB_2905463 goat anti-mouse IgG, Alexa Fluor 633 Thermo Fisher RRID: AB_2535719 goat anti-rabbit IgG, Alexa Fluor 555 Thermo Fisher RRID: AB_141784 goat anti-chicken IgY, Alexa Fluor 488 Thermo Fisher RRID: AB_142924 Experimental models: Organisms/strains Tg(mbp:memCerulean)tum101Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-3 Tg(mbp:KillerRed)tum103Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-5 Tg(mbp:tagRFPt-CAAX)tum102Tg Auer et al. (2018) ZFIN: ZDB-ALT-180712-4 Tg(cntn1b(3kb):KalTA4) This paper N/A Tg(olig1:mScarlet-CAAX) This paper N/A CRISPR-NfascaD28 This paper N/A Oligonucleotides For all oligonucleotides used, see Table S1 this paper N/A Recombinant DNA p5E_cntn1b(3kb) this paper N/A pME_EYFPnostop_NaV-II-III this paper N/A pME_sigpepEYFP_cntn1a this paper N/A p5E_cntn1b(5kb) Czopka et al. (2013) N/A pME_KalTA4GI Almeida and Lyons (2015) N/A p5E_UAS(10x) Kwan et al. (2007) N/A p3E_pA Kwan et al. (2007) N/A pDestTol2_pA Kwan et al. (2007) N/A pME_tagCFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):Nfasca-EYFP Auer et al. (2018) N/A pTol2_cntn1b(5kb):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):EYFP-NaV-II-III this paper N/A pTol2_UAS(10x):EYFP-cntn1a this paper N/A pTol2_cntn1b(5kb):tagCFP this paper N/A pTol2_cntn1b(5kb):mCherry Czopka et al. (2013) N/A Software and algorithms Fiji http://fiji.sc/ RRID: SCR_002285 Imaris Bitplane RRID: SCR_007370 Imaris FilamentTracer Bitplane RRID: SCR_007366 Huygens Essential Scientific Volume Imaging RRID: SCR_014237 Graphpad Prism 8 Graphpad Software RRID: SCR_015807 Code for simulation of cluster-node correlation This paper ZENODO DOI: https://doi.org/10.5281/zenodo.5846391. ..

    Microscopy:

    Article Title: Early molecular layer interneuron hyperactivity triggers Purkinje neuron degeneration in SCA1
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti parvalbumin Swant Cat#235; RRID: AB_10000343 Goat anti parvalbumin Swant Cat#PVG214; RRID: AB_10000345 Mouse anti calbindin Abcam Cat#ab82812; RRID: AB_1658451 Rabbit anti calbindin Abcam Cat#ab108404; RRID: AB_10861236 Rabbit anti-pCaMKII-a Santa cruz Cat#sc-12886-R; RRID: AB_2067915 Rabbit anti-CaMKII-a Lifespan Bio Cat#1178-50; RRID: AB_968870 Goat anti mCherry Origene Cat#AB0081; RRID: AB_2333094 Rabbit polyclonal anti mCherry Abcam Cat#ab183628; RRID: AB_2650480 Rabbit anti VGluT1 SYSY Cat#135303; RRID: AB_887875 Rabbit anti VGAT SYSY Cat#131003; RRID: AB_887869 Rabbit anti HOMER-3 Origene Cat#TA308627 Rabbit anti HOMER-3 SYSY Cat#160303; RRID: AB_10804288 Mouse anti GFP ABCAM Cat#AB1218; RRID: AB_298911 Mouse anti myc Cell signaling Cat# 2276; RRID: AB_331783 Mouse anti Frrs1l Santa cruz Cat# sc-398692 Mouse anti GluR2 Millipore Cat#MAB397; RRID: AB_11212990 Chicken anti MAP2 Sigma/Millipore Cat#AB15452; RRID: AB_805385 rabbit anti GABA Sigma Cat#A2052; RRID: AB_477652 Rabbit anti KV1.2 Thermo Fisher Scientific Cat# PA5-77578; RRID: AB_2736054 Rabbit anti-GFAP Sigma Cat#G4546; RRID: AB_1840895 Rabbit anti-SORCS3 Novus Cat##NBP1-30615; RRID: AB_2192266 Donkey anti-Goat IgG (H+L) CrossAdsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen, Thermo Fisher Scientific Catalog # A-11058 Neurotrace 435/455 blue fluorescent Nissl stain Invitrogen, Thermo Fisher Scientific Catalog number: N21479 Bacterial and virus strains AAV2/1-hSyn-GCaMP7S-WPRE Dana et al.20 Addgene: 104487-AAV1 AAV2/1-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV1 AAV2/2-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV2 AAV2/8-hSyn-DIO-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50459-AAV8 AAV2/8-hSyn-DIO-hM3D(Gq)-mCherry Krashes et al.77 Addgene: 44361-AAV8 AAV2/8-hSyn-DIO-hM4D(Gi)-mCherry Krashes et al.77 Addgene: 44362-AAV8 AAV2/2-hSyn-DIO-hM4D(Gi)-mCherry Unpublished, a gift from Bryan Roth to Addgene Addgene: 50475-AAV2 AAV2/1-hSyn-GCaMP6s-WPRE-SV40 Chen et al.19 Addgene: 100843-AAV1 AAV2/1-Syn-NES-jRCaMP1a-WPRE-SV40 Dana et al.78 Addgene: 100848-AAV1 AAV2/1-hSyn-Twitch2B-WPRE-SV40 Thestrup et al.23 Addgene: 100040- AAV1 (Continued on next page) e1 Neuron 111, 2523–2543.e1–e10, August 16, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER C9orf4 (FRRS1L) - Human shRNA lentiviral particles Origene: CAT# TL314264V C9ORF4 (FRRS1L) - Human Myc-DDKtagged lentiviral particles Origene: CAT#: RC221300L1V Chemicals, peptides, and recombinant proteins SB 431542 Stem cell technologies Cat#72234 LDN193189 Stem cell technologies Cat#72147 CHIR99021 Stem cell technologies Cat#72052 L-Ascorbic Acid Sigma Aldrich Cat#A4403 SAG Stem cell technologies Cat#73412 BDNF Stem cell technologies Cat#78005 DAPT Stem cell technologies Cat#72082 GDNF Stem cell technologies Cat#78058 IGF-1 Stem cell technologies Cat#78078 CNTF Stem cell technologies Cat#78010 Clozapine N-Oxide Tocris Cat#4936 Experimental models: Cell lines Human induced pluripotent stem cell (SCA1) Buijsen et al.38 LUMCi002 Human induced pluripotent stem cell (Healthy) Buijsen et al.38 LUMCi003 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi034 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi035 Human induced pluripotent stem cell (SCA1) Leiden University Medical Center LUMCi022 Human induced pluripotent stem cell (Healthy) Leiden University Medical Center LUMCi023 Experimental models: Organisms/strains B6.129S-Atxn1tm1Hzo/J Jackson laboratories RRID: IMSR_JAX:005601 B6;129P2-Pvalbtm1(cre)Arbr/J Jackson laboratories RRID: IMSR_JAX:008069 B6.129-Tg(Pcp2-cre)2Mpin/J Jackson laboratories RRID: IMSR_JAX:004146 Software and algorithms Fiji https://doi.org/10.1038/nmeth.2019 RRID:SCR_002285 Imaris Oxford instruments RRID:SCR_007370 iMOD Kremer et al.79 RRID:SCR_003297 Graphpad prism http://www.graphpad.com/ RRID:SCR_002798 MATLAB R2018a version The MathWorks, Inc https://de.mathworks.com/ RRID:SCR_001622 Custom built software on Labview 2018 SP1, 2020 SP1, National Instruments Keller et al.80 National Instruments https://www.ni.com/de-de/shop/ software/products/labview.html SciScan 1.4 - Imaging acquisition software Scientfica UK N/A Other IR camera Imaging source DMK 22BUC03 Ti:Sapphire laser with a DeepSee pre-chirp unit Spectra Physics MaiTai HP N/A Two-photon microscope, equipped with an 8 kHz resonant scanner Hyperscope, Scientifica N/A 316 water-immersion objective (0.8 NA) Nikon N/A (Continued on next page) ll OPEN ACCESSArticle Neuron 111, 2523–2543.e1–e10, August 16, 2023 e2 ..

    Article Title: Early stress-induced impaired microglial pruning of excitatory synapses on immature CRH-expressing neurons provokes aberrant adult stress responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-vGlut2 antiserum Millipore Cat# AB2251-I; RRID: AB_2665454 Rabbit anti-PSD95 antiserum Invitrogen/ThermoFisher Cat# 51-6900; RRID: AB_2533914 Rabbit anti-Iba1 antiserum Wako Chemical Cat# 019-19741; RRID: AB_839504 Rat anti-MerTK antiserum eBioscience Cat# 14-5751-82; RRID: AB_2688282 Rabbit anti-P2RY12 antiserum AnaSpec Cat# 55043A; RRID: AB_2298886 Chemicals, peptides, and recombinant proteins Clozapine-N-oxide (CNO) National Institute of Mental Health CAS# 34233-69-7, MH# C-929 MerTK small-molecule inhibitor, UNC2025 Selleck Chemicals Cat# S7576 CNO-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# X-999 Placebo-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# C-111 Critical commercial assays ACTH ELISA kit Phoenix Pharmaceuticals Cat# EK-001-21 CORT ELISA kit Cayman Chemicals Cat# 501320 Experimental models: Organisms/strains Mouse: CRH-IRES-Cre+/+ Jackson Laboratory JAX: 012704 Mouse: tdTomato+/+ Ai14 Jackson Laboratory JAX: 007914 Mouse: CX3CR1-GFP+/+ Jackson Laboratory JAX: 005582 Mouse: CX3CR1-BAC-Cre+ [Tg(Cx3cr1cre)MW126Gsat] GENSAT BAC Transgenic Project (Rockefeller University) MMRRC: 036395-UCD; MGI: 5311737 Mouse: Gq-DREADD+/- (stop-floxed) Jackson Laboratory JAX: 026220 Mouse: Mertkfl/fl Dr. Carla Rothlin (Yale University); Fourgeaud et al., 2016 N/A Mouse: C57BL/6J (wild-type) Jackson Laboratory JAX: 000664 Software and algorithms FIJI https://imagej.net/software/fiji/; Schindelin et al., 2012 N/A Imaris 3D reconstruction software Bitplane N/A Strathclyde Electrophysiology Software (Electrophysiology Data Recorder [WinEDR] and Whole-Cell analysis Program [WinWCP]) Courtesy of Dr J. Dempster, University of Strathclyde N/A Slidebook microscopy software 3i (Intelligent Imaging Innovations) N/A Python-based microglial process dynamics analysis algorithm This paper, available: https:// github.com/jaclynrbeck/ BaramLabMicrogliaTracking N/A ProMoIJ plug-in for FIJI Paris et al., 2017 N/A MultipleKymograph plug-in for FIJI http://www.embl.de/eamnet/ html/body_kymograph.html N/A Other Fine-gauge plastic-coated aluminum mesh platform (mesh dimensions 0.4 X 0.9 cm) McNichols Co. Cat# 57398 Cell Reports 38, 110600, March 29, 2022 e1 ..

    RNAscope:

    Article Title: Spatial organization and function of RNA molecules within phase-separated condensates in zebrafish are controlled by Dnd1.
    Article Snippet: Agarose Invitrogen Cat# 15517014 DMDAPatA Daniel Romo N/A CHX Sigma Cat# C4859 DAPI ACD Cat# 320858 DMSO AppliChem Cat# A3672 Critical commercial assays Manual RNAscope Multiplex Fluorescent Detection Reagents ACD Cat# 320851 RNAscope Protease III and Protease IV reagents ACD Cat# 322340 mMessage mMachine sp6 Kit Thermo Fisher Cat# AM1340 mMessage mMachine T3 Kit Thermo Fisher Cat# AM1348 mMessage mMachine T7 Kit Thermo Fisher Cat# AM1344 Experimental models: Organisms/strains Zebrafish: wildtype strain of the AB(TL) background N/A N/A Zebrafish: cxcr4bt26035 Knaut et al.66 ZFIN: ZDB-ALT-030312-2 Zebrafish: medusaNYO45 Valentin et al.67 ZFIN: ZDB-ALT-060608-480 Zebrafish: tg(kop:egfp-f-nos-3’ UTR;cry:dsred) Blaser et al.45 ZFIN: ZDB-ALT-070406-1 Zebrafish: tg(buc:buc-egfp) Riemer et al.50 ZFIN: ZDB-ALT-151209-1 Zebrafish: bucp106re Bontems et al.49 ZFIN: ZDB-ALT-040224-4 Zebrafish: dicerhu715 Wienholds et al.68 ZFIN: ZDB-ALT-030922-6 Oligonucleotides Injected RNAs See Table S1 See Table S1 (Continued on next page) Developmental Cell 58, 1578–1592.e1–e5, September 11, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Morpholinos See Table S1 See Table S1 miRNA and RNAscope detection probes See Table S1 See Table S1 Software and algorithms Fiji (version 2.0.0-rc-43/1.51a) NIH https://fiji.sc/ Imaris (version 8.4.2) Oxford Instruments https://imaris.oxinst.com/ Huygens Professional (version 19.04) SVI http://svi.nl Prism (version 9.4.0) Graphpad https://www.graphpad.com/scientific- software/prism/ VisiView (version 4.0.0.14) Visitron http://www.visitron.de/Products/ Software/VisiView/visiview.html ZEN (version 2010B SP1, 6.0) Zeiss https://www.zeiss.com/microscopy/ en/products/software/zeiss-zen.html ..

    Enzyme-linked Immunosorbent Assay:

    Article Title: Early stress-induced impaired microglial pruning of excitatory synapses on immature CRH-expressing neurons provokes aberrant adult stress responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-vGlut2 antiserum Millipore Cat# AB2251-I; RRID: AB_2665454 Rabbit anti-PSD95 antiserum Invitrogen/ThermoFisher Cat# 51-6900; RRID: AB_2533914 Rabbit anti-Iba1 antiserum Wako Chemical Cat# 019-19741; RRID: AB_839504 Rat anti-MerTK antiserum eBioscience Cat# 14-5751-82; RRID: AB_2688282 Rabbit anti-P2RY12 antiserum AnaSpec Cat# 55043A; RRID: AB_2298886 Chemicals, peptides, and recombinant proteins Clozapine-N-oxide (CNO) National Institute of Mental Health CAS# 34233-69-7, MH# C-929 MerTK small-molecule inhibitor, UNC2025 Selleck Chemicals Cat# S7576 CNO-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# X-999 Placebo-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# C-111 Critical commercial assays ACTH ELISA kit Phoenix Pharmaceuticals Cat# EK-001-21 CORT ELISA kit Cayman Chemicals Cat# 501320 Experimental models: Organisms/strains Mouse: CRH-IRES-Cre+/+ Jackson Laboratory JAX: 012704 Mouse: tdTomato+/+ Ai14 Jackson Laboratory JAX: 007914 Mouse: CX3CR1-GFP+/+ Jackson Laboratory JAX: 005582 Mouse: CX3CR1-BAC-Cre+ [Tg(Cx3cr1cre)MW126Gsat] GENSAT BAC Transgenic Project (Rockefeller University) MMRRC: 036395-UCD; MGI: 5311737 Mouse: Gq-DREADD+/- (stop-floxed) Jackson Laboratory JAX: 026220 Mouse: Mertkfl/fl Dr. Carla Rothlin (Yale University); Fourgeaud et al., 2016 N/A Mouse: C57BL/6J (wild-type) Jackson Laboratory JAX: 000664 Software and algorithms FIJI https://imagej.net/software/fiji/; Schindelin et al., 2012 N/A Imaris 3D reconstruction software Bitplane N/A Strathclyde Electrophysiology Software (Electrophysiology Data Recorder [WinEDR] and Whole-Cell analysis Program [WinWCP]) Courtesy of Dr J. Dempster, University of Strathclyde N/A Slidebook microscopy software 3i (Intelligent Imaging Innovations) N/A Python-based microglial process dynamics analysis algorithm This paper, available: https:// github.com/jaclynrbeck/ BaramLabMicrogliaTracking N/A ProMoIJ plug-in for FIJI Paris et al., 2017 N/A MultipleKymograph plug-in for FIJI http://www.embl.de/eamnet/ html/body_kymograph.html N/A Other Fine-gauge plastic-coated aluminum mesh platform (mesh dimensions 0.4 X 0.9 cm) McNichols Co. Cat# 57398 Cell Reports 38, 110600, March 29, 2022 e1 ..

    BAC Assay:

    Article Title: Early stress-induced impaired microglial pruning of excitatory synapses on immature CRH-expressing neurons provokes aberrant adult stress responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-vGlut2 antiserum Millipore Cat# AB2251-I; RRID: AB_2665454 Rabbit anti-PSD95 antiserum Invitrogen/ThermoFisher Cat# 51-6900; RRID: AB_2533914 Rabbit anti-Iba1 antiserum Wako Chemical Cat# 019-19741; RRID: AB_839504 Rat anti-MerTK antiserum eBioscience Cat# 14-5751-82; RRID: AB_2688282 Rabbit anti-P2RY12 antiserum AnaSpec Cat# 55043A; RRID: AB_2298886 Chemicals, peptides, and recombinant proteins Clozapine-N-oxide (CNO) National Institute of Mental Health CAS# 34233-69-7, MH# C-929 MerTK small-molecule inhibitor, UNC2025 Selleck Chemicals Cat# S7576 CNO-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# X-999 Placebo-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# C-111 Critical commercial assays ACTH ELISA kit Phoenix Pharmaceuticals Cat# EK-001-21 CORT ELISA kit Cayman Chemicals Cat# 501320 Experimental models: Organisms/strains Mouse: CRH-IRES-Cre+/+ Jackson Laboratory JAX: 012704 Mouse: tdTomato+/+ Ai14 Jackson Laboratory JAX: 007914 Mouse: CX3CR1-GFP+/+ Jackson Laboratory JAX: 005582 Mouse: CX3CR1-BAC-Cre+ [Tg(Cx3cr1cre)MW126Gsat] GENSAT BAC Transgenic Project (Rockefeller University) MMRRC: 036395-UCD; MGI: 5311737 Mouse: Gq-DREADD+/- (stop-floxed) Jackson Laboratory JAX: 026220 Mouse: Mertkfl/fl Dr. Carla Rothlin (Yale University); Fourgeaud et al., 2016 N/A Mouse: C57BL/6J (wild-type) Jackson Laboratory JAX: 000664 Software and algorithms FIJI https://imagej.net/software/fiji/; Schindelin et al., 2012 N/A Imaris 3D reconstruction software Bitplane N/A Strathclyde Electrophysiology Software (Electrophysiology Data Recorder [WinEDR] and Whole-Cell analysis Program [WinWCP]) Courtesy of Dr J. Dempster, University of Strathclyde N/A Slidebook microscopy software 3i (Intelligent Imaging Innovations) N/A Python-based microglial process dynamics analysis algorithm This paper, available: https:// github.com/jaclynrbeck/ BaramLabMicrogliaTracking N/A ProMoIJ plug-in for FIJI Paris et al., 2017 N/A MultipleKymograph plug-in for FIJI http://www.embl.de/eamnet/ html/body_kymograph.html N/A Other Fine-gauge plastic-coated aluminum mesh platform (mesh dimensions 0.4 X 0.9 cm) McNichols Co. Cat# 57398 Cell Reports 38, 110600, March 29, 2022 e1 ..

    Transgenic Assay:

    Article Title: Early stress-induced impaired microglial pruning of excitatory synapses on immature CRH-expressing neurons provokes aberrant adult stress responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-vGlut2 antiserum Millipore Cat# AB2251-I; RRID: AB_2665454 Rabbit anti-PSD95 antiserum Invitrogen/ThermoFisher Cat# 51-6900; RRID: AB_2533914 Rabbit anti-Iba1 antiserum Wako Chemical Cat# 019-19741; RRID: AB_839504 Rat anti-MerTK antiserum eBioscience Cat# 14-5751-82; RRID: AB_2688282 Rabbit anti-P2RY12 antiserum AnaSpec Cat# 55043A; RRID: AB_2298886 Chemicals, peptides, and recombinant proteins Clozapine-N-oxide (CNO) National Institute of Mental Health CAS# 34233-69-7, MH# C-929 MerTK small-molecule inhibitor, UNC2025 Selleck Chemicals Cat# S7576 CNO-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# X-999 Placebo-containing, sustained-release pellets (s.c.) Innovative Research of America Cat# C-111 Critical commercial assays ACTH ELISA kit Phoenix Pharmaceuticals Cat# EK-001-21 CORT ELISA kit Cayman Chemicals Cat# 501320 Experimental models: Organisms/strains Mouse: CRH-IRES-Cre+/+ Jackson Laboratory JAX: 012704 Mouse: tdTomato+/+ Ai14 Jackson Laboratory JAX: 007914 Mouse: CX3CR1-GFP+/+ Jackson Laboratory JAX: 005582 Mouse: CX3CR1-BAC-Cre+ [Tg(Cx3cr1cre)MW126Gsat] GENSAT BAC Transgenic Project (Rockefeller University) MMRRC: 036395-UCD; MGI: 5311737 Mouse: Gq-DREADD+/- (stop-floxed) Jackson Laboratory JAX: 026220 Mouse: Mertkfl/fl Dr. Carla Rothlin (Yale University); Fourgeaud et al., 2016 N/A Mouse: C57BL/6J (wild-type) Jackson Laboratory JAX: 000664 Software and algorithms FIJI https://imagej.net/software/fiji/; Schindelin et al., 2012 N/A Imaris 3D reconstruction software Bitplane N/A Strathclyde Electrophysiology Software (Electrophysiology Data Recorder [WinEDR] and Whole-Cell analysis Program [WinWCP]) Courtesy of Dr J. Dempster, University of Strathclyde N/A Slidebook microscopy software 3i (Intelligent Imaging Innovations) N/A Python-based microglial process dynamics analysis algorithm This paper, available: https:// github.com/jaclynrbeck/ BaramLabMicrogliaTracking N/A ProMoIJ plug-in for FIJI Paris et al., 2017 N/A MultipleKymograph plug-in for FIJI http://www.embl.de/eamnet/ html/body_kymograph.html N/A Other Fine-gauge plastic-coated aluminum mesh platform (mesh dimensions 0.4 X 0.9 cm) McNichols Co. Cat# 57398 Cell Reports 38, 110600, March 29, 2022 e1 ..



    Similar Products

    algorithms gen5 software biotek n a metamorph 7 8 13 gataca systems n a fiji nih  (Gataca Inc)
    86
    Gataca Inc algorithms gen5 software biotek n a metamorph 7 8 13 gataca systems n a fiji nih
    Algorithms Gen5 Software Biotek N A Metamorph 7 8 13 Gataca Systems N A Fiji Nih, supplied by Gataca Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/13+7+8+a+a+algorithms+biotek+fiji+gataca+gen5+metamorph+n+n+nih+software+systems/pm41996234-680-156-163
    Average 86 stars, based on 1 article reviews
    algorithms gen5 software biotek n a metamorph 7 8 13 gataca systems n a fiji nih - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst  (Oxford Instruments)
    99
    Oxford Instruments algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst
    Algorithms Bitplane Imaris 9 2 Oxford Instruments Rrid Scr 007370 Fiji Nih Rrid Scr 002285 Clearmap 3 1 Kirst, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/Imaris/pm41985458-259-279-280
    Average 99 stars, based on 1 article reviews
    algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms fiji imagej n a rrid scr 002285 other  (Fisher Scientific)
    86
    Fisher Scientific algorithms fiji imagej n a rrid scr 002285 other
    Algorithms Fiji Imagej N A Rrid Scr 002285 Other, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/002285+a+algorithms+fiji+imagej+n+other+rrid+scr/pm41518617-38-161-171
    Average 86 stars, based on 1 article reviews
    algorithms fiji imagej n a rrid scr 002285 other - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms fiji imagej nih  (Nikon)
    99
    Nikon algorithms fiji imagej nih
    Algorithms Fiji Imagej Nih, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/NIS-Elements/pm41861814-221-189-197
    Average 99 stars, based on 1 article reviews
    algorithms fiji imagej nih - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms fiji version 1 54 open source  (Addgene inc)
    92
    Addgene inc algorithms fiji version 1 54 open source
    Algorithms Fiji Version 1 54 Open Source, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/MtPT4+(Plasmid+%23117096)/pm41832956-224-238-233
    Average 92 stars, based on 1 article reviews
    algorithms fiji version 1 54 open source - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    algorithms fiji schindelin  (Oxford Instruments)
    99
    Oxford Instruments algorithms fiji schindelin
    Algorithms Fiji Schindelin, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/Imaris/pm41702401-1173-21-42
    Average 99 stars, based on 1 article reviews
    algorithms fiji schindelin - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms imagej fiji schneider  (Oxford Instruments)
    99
    Oxford Instruments algorithms imagej fiji schneider
    Algorithms Imagej Fiji Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/Imaris/pm41689806-832-115-121
    Average 99 stars, based on 1 article reviews
    algorithms imagej fiji schneider - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms imaris 9 3 1 bitplane n a imagej fiji n a cell reports 45  (Oxford Instruments)
    99
    Oxford Instruments algorithms imaris 9 3 1 bitplane n a imagej fiji n a cell reports 45
    Algorithms Imaris 9 3 1 Bitplane N A Imagej Fiji N A Cell Reports 45, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/Imaris/pm41447531-268-144-145
    Average 99 stars, based on 1 article reviews
    algorithms imaris 9 3 1 bitplane n a imagej fiji n a cell reports 45 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms fiji imagej nih  (Deepmind Technologies Ltd)
    86
    Deepmind Technologies Ltd algorithms fiji imagej nih
    Algorithms Fiji Imagej Nih, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/algorithms+fiji+imagej+nih/pm41420865-264-223-251
    Average 86 stars, based on 1 article reviews
    algorithms fiji imagej nih - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms imagej fiji schneider  (Nikon)
    99
    Nikon algorithms imagej fiji schneider
    Algorithms Imagej Fiji Schneider, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+fiji/NIS-Elements/pm41385382-60-8-17
    Average 99 stars, based on 1 article reviews
    algorithms imagej fiji schneider - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results